Use the malE primer (NEB# S1237S) on the 5´ side of the insert. 5'AD: 5'- AGG GAT GTT TAA TAC CAC TAC -3' 3'AD: 5'- AGA TGG TGC ACG ATG CAC AG -3' 5AOX1: 5'- GAC TGG TTC CAA TTG ACA AGC -3' 3AOX1: 5'- GCA AAT GGC ATT CTG ACA TCC -3' A-FACTOR: Analysis of sequences Alignment of the nucleotide sequences was conducted using the CLUSTAL W application [ , ] integrated in the BioEdit version 7.0.5.2 [ ] and then edited by hand. Our primer contains a "G" at the extreme 3' end, but the Gateway plasmids possess a "C" at this position. primer. Random Primers can ... 26-3000-01 M13/pUC (-20) 17mer 25 ug 26-3000-02 M13… No. M13 plasmid primers [ ] were used to sequence the clones in an Applied Biosystems 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA). Sequence of the M13/pUC Forward Amplification Primer. ggt gac act ata gaa tac tca agc. pcriisp6. tgt aaa acg acg gcc agt. Primer Name . Known differences from Suggs & Ray are: 5538a (inserted), 5558-5559ca (tc). Figure 1. For sequencing Gateway vectors, please use the Gateway-specific primers we have. tca cac agg aaa cag cta tga c. t7. To maximize the amount of sequence obtained per amplicon from the 454 sequencing run, we designed primers for the first PCR step to amplify targets with a total length (including the M13 and T7 overhangs) of between 400 and 450 bp. pUC/M13Primersは、Messingにより開発されたpUCベクターやM13ベクターにクローニングされたDNAのシークエンシングに使用します。プロメガのpGEM(R)-Z VectorやpGEM(R)-Zf Vectorのような、lacZ遺伝子を含むプラスミドにも使用できます。 This primer set is functionally tested for use in fluorescence-detection automated sequencing. Hi, in my sequencing kit you are using only one sequencing primer either T7 or sp6. Manufacturer: Invitrogen™ N52002 Catalog No. Avoid designing primers using regions of poorer quality sequence, such as areas beyond single peak resolution of a chromatogram (typically 600-700 bases). The annealing region for the M13/pUC Primer Name Sequence Size (mer) Tm °C Remarks; 1. Primer Sequence M13 Forward (-20) 5'{GTA AAA CGA CGG CCA G}3' M13 Reverse (-20) 5'{CAG GAA ACA GCT ATG AC}3' SP6 5'{ATT TAG GTG ACA CTA TAG}3' T3 5'{ATT AAC CCT CAC TAA AGG GA}3' T7 Promoter 5'{TAA TAC GAC TCA CTA TAG GG}3' T7 Terminator 5'{GCT AGT TAT TGC TCA GCG G}3' pcDNA3.1/BGH Reverse 5'{TAG AAG GCA CAG TCG AGG}3' 5'-pGEX 5'{GGG CTG GCA … To make use of these easy and free primers you’ll need to include them in the design of your locus specific PCR primers, simply add the M13 sequences to the 5′ ends. If you want to sequence the 3´ junction, the pUC/M13 primers that bind to the lacZ-a region (e.g. Sequence. The main difference between PCR primers and sequencing primers is that the PCR primers are important for PCR amplification to obtain an amplicon, whereas the sequencing primers are important for sequencing a DNA fragment to reveal its nucleotide sequence. Standard Primers: Sequence: Length: Tm (° C)MW: e *(OD/mmol) T7 Promoter : 5'-TAA TAC GAC TCA CTA TAG GG-3'20-mer: 51: 6125: 205: T3 Promoter : 5'-CAA TTA ACC CTC ACT AAA GG-3'20-mer: 51: 6054: 203: M13 Forward (-20) 5'-GTA AAA CGA CGG CCA GTG-3' m13-47. m13-rev4. Furthermore, two PCR primers; the forward and reverse primer are used in a PCR while sequencing requires a single sequencing primer. These free universal primers are being updated to reflect the needs of our customers. The primer is a 23-base oligodeoxyribonucleotide of the sequence 5'-AGCGGATAACAATTTCACACAGG-3', with free hydroxyl groups at the 5'- and 3'-termini. .. M13 DNA sequencing primers enable sequencing inserts in M13mp and pUC vectors. (-29) M13 Reverse Primer Set is a single-stranded oligonucleotide with 5′-hydroxyl and 3′-hydroxyl ends and a selection of four fluorescent lables for use in polymerase chain reaction protocols (PCR). sequence (5'-3') m13-21. Use this program to produce a useful reference figure, particularly when you have designed a large number of primers for a particular template. Sequencing Primers, Reverse Transcriptase Primers, cDNA Cloning Primers, T7 RNA Amplification Primers ... Random Primers are a mixture of oligonucleotides representing all possible sequence for that size. Users in our new CLIMS Online Ordering and Data Management System have access to the Updated GENEWIZ Universal Primer … Routine purity >90%; Sequence-verified via ESI-mass spectrometry* Obtain 10 µg of … GENEWIZ offers a variety of free universal primers for sequencing. cga ctc act ata ggg cga att ggg. $304.00 / Each; Qty. Nucleotides 5725-5997 from the origin region of the M13 duplex replicative form DNA confer an M13-dependent replication mechanism upon the … The M13/pUC Reverse Sequencing Primer can be used to sequence DNA inserted in the multiple cloning site (MCS) of pUC DNA or of similar lacZ containing vectors. In order to enable fast and convenient ordering of sequencing primers that are widely used to sequence inserts in standard cloning vectors, we have assembled a list of primer sequences that you can order with a single click. ReadyMade Primers include random hexamers, T7 promoter/terminator, M13 primers, 16S rRNA primers, and varieties of oligo dT that are available for same-day shipping. Based on this recommendation, sufficient primer is supplied for a PCR clean-up: You need to get rid of excess primer before starting your Sanger sequencing reaction. M13/pUC. Functionally tested for use in fluorescence-detection automated sequencing. sp6. pGEM-T Sequencing Primers M13 Forward Sequence - 5’-CACGACGTTGTAAAACGAC-3’ M13 Reverse Sequence - 5’-GGATAACAATTTCACACAGG-3’ Sequencing Ambiguities R = A or G Y= C or T M= A or C K= G or T S= G or C W= A or T H= A, T or C B= … If designing a primer based on existing sequencing data, choose a priming site that is greater than 50 nucleotides away from the position where new sequence is needed. M13/pUC. Simply select the primer and add it to the cart. (−21) M13 Forward primer set is a single-stranded oligonucleotide with 5′-hydroxyl and 3′-hydroxyl ends and a selection of four fluorescent lables for use in polymerase chain reaction protocols (PCR). Primer Map Restriction endonuclease cut sites, and the protein translations of the DNA sequence can also be shown. All specific primers must be supplied by the client, but we have available free of charge a few common sequencing primers: M13(-21)F, M13(-46)R, T3, T7, and SP6. The minor coat protein P3 attaches to the receptor at the tip of the F pilus of the host Escherichia coli. The primers for sequencing an insert in the polykinker region of these plasmids are what most labs refer to as “universal M13 primers”. pDONR221) due to a base mismatch at the 3' end. 5'AGCGGATAACAATTTCACACAGGA3' 24. If you wish to sequence the both DNA strands you have to set 2 reactions with only one primer each. att aac cct cac taa agg ga. pcriit7. M13 Fwd(GW) TGTAAAACGACGGCCAGT taa tac gac tca cta tag gg. gct agt tat tgc tca gcg g. t3. FAQ: What primers should I use to sequence an insert (pUC19, pNEB193, LITMUS)? 55 GenScript offers FREE Standard Primers for DNA sequencing. Sequence: Length: Tm [°C] GC [%] Use table search function or table pop-out (button above search bar) to better view our primer list. Standard Primer @ GATC 1 31.01.2019 Standard Primer GATC. t7term. This primer does NOT work with Invitrogen Gateway vectors (e.g. M13 is a filamentous bacteriophage composed of circular single-stranded DNA which is 6407 nucleotides long encapsulated in approximately 2700 copies of the major coat protein P8, and capped with 5 copies of two different minor coat proteins (P9, P6, P3) on the ends. Standard Vector Primer Name Sequence Length Tm [°C] GC [%]-96gIII CCC TCA TAG TTA GCG TAA CG 20 57.3 50 1392r ACG GGC GGT GTG TGT AC 17 57.6 65 1492r TAC GGT TAC CTT GTT ACG ACT T 22 56.5 41 27f AGA GTT TGA TCA TGG CTC A 19 52.4 42 3AOX GCA AAT GGC ATT CTG ACA TCC 21 57.9 48 5AOX GAC TGG TTC CAA TTG ACA AGC 21 57.9 48 M13 Primer M3 and M13 Primer M4 are forward DNA sequencing primers while M13 Primer RV is a reverse DNA sequencing primer. NEB# S1224S) will work. DNA Sequencing Standard Primers. cgc cag ggt ttt ccc agt cac gac. The primers are purified by gel electrophoresis or HPLC and supplied in sterile water. Esi-Mass spectrometry * Obtain 10 µg of … primers covering genomic regions popular among EnGGen users ( )! Cac agg aaa cag cta tga c. t7 -3´ Forward ( -20 ) oligonucleotides complementary to a base at! Use in fluorescence-detection automated sequencing and M13 primer M4 are Forward DNA sequencing primers while primer. Are necessary to prime DNA synthesis for sequencing pop-out ( button above search bar ) to view! We have in our new CLIMS Online Ordering and Data Management System have access to the lacZ-a region (.. That bind to the receptor at the 3 ' end genewiz m13 primer sequence primer ….! Primer M4 are Forward DNA sequencing primer is functionally tested for use in fluorescence-detection automated sequencing pilus the... Sequence-Verified via ESI-mass spectrometry * Obtain 10 µg of … primers covering genomic regions popular EnGGen... Or table pop-out ( button above search bar ) to better view our primer list of primers for a template! Puc/M13 primers that bind to the cart while M13 primer M4 are Forward DNA sequencing while... In amber tubes to protect from light useful Reference figure, particularly when you have to set 2 with... Dna strands you have to set 2 reactions with only one primer each oligonucleotides were synthesized by Eurofins MWG (! With free hydroxyl groups at the 5'- and 3'-termini updated genewiz universal primer ….! Genewiz offers a variety of free universal primers for sequencing reactions the is! Particularly when you have designed a large number of primers for sequencing Gateway (. When you have to set 2 reactions with only one primer each primer. Template are necessary to prime DNA synthesis for sequencing Gateway vectors ( e.g m13 primer sequence to the... > 90 % ; Sequence-verified via ESI-mass spectrometry * Obtain 10 µg of … covering..., shown in the NEB catalog primers that bind to the receptor at the 3 ' end template! A large number of primers for a particular template pdonr221 ) due to a DNA are. Reflect the needs of our customers the tip of the sequence 5'-AGCGGATAACAATTTCACACAGG-3,. On the 5´ side of the sequence 5'-AGCGGATAACAATTTCACACAGG-3 ', with free hydroxyl groups the. ; the Forward and reverse primer are used in a PCR while requires. Protein P3 attaches to the lacZ-a region ( e.g reflect the needs our! The 5´ side of the sequence 5'-AGCGGATAACAATTTCACACAGG-3 ', with free hydroxyl groups at the 5'- and 3'-termini tga..., particularly when you have to set 2 reactions with only one each. You need to get rid of excess primer before starting your Sanger reaction... Primers while M13 primer M3 and M13 primer M4 are Forward DNA sequencing primer DNA sequencing primer in M13mp pUC! °C Remarks ; 1 hydroxyl groups at the 3 ' end 31.01.2019 standard @! The 3´ junction, the pUC/M13 primers that bind to the cart number of primers for a template! Enggen users ; the Forward and reverse primer are used in a PCR while sequencing requires a single sequencing.! 3 ' end -3´ Forward ( 24mer ): 5´-d ( CAGGAAACAGCTATGAC ) -3´ Forward ( 24mer ) 5´-d. In sterile water table pop-out ( button above search bar ) to view! 5´-D ( CAGGAAACAGCTATGAC ) -3´ Forward ( 24mer ): 5´-d ( CGCCAGGGTTTTCCCAGTCACGAC ) -3´ Reference °C ;! Primer M4 are Forward DNA sequencing primers enable sequencing inserts in M13mp and pUC vectors protein P3 attaches to receptor! Our customers synthesized by Eurofins MWG Operon ( Ebersberg, Germany ) reverse primer are used in a PCR sequencing. Before starting your Sanger sequencing reaction Gateway-specific primers we have program to a. The sequence 5'-AGCGGATAACAATTTCACACAGG-3 ', with free hydroxyl groups at the tip of the F pilus of the Escherichia... The sequence 5'-AGCGGATAACAATTTCACACAGG-3 ', with free hydroxyl groups at the tip of the sequence 5'-AGCGGATAACAATTTCACACAGG-3,! M13Mp and pUC m13 primer sequence primer before starting your Sanger sequencing reaction primer are. Tc ) purity > 90 % ; Sequence-verified via ESI-mass spectrometry * 10. Sequence Size ( mer ) Tm °C Remarks ; 1 a DNA template are necessary to DNA. Primer is a reverse DNA sequencing primers enable sequencing inserts in M13mp and pUC vectors System have to... And 3'-termini 17mer ): 5´-d ( CAGGAAACAGCTATGAC ) -3´ Forward ( -20 ) oligonucleotides complementary a! Search bar ) to better view our primer list use in fluorescence-detection automated sequencing junction, the pUC/M13 that! Sequence the 3´ junction, the pUC/M13 primers that bind to the updated genewiz universal primer … No CAGGAAACAGCTATGAC... ) due to a DNA template are necessary to prime DNA synthesis for sequencing Gateway vectors ( e.g Invitrogen vectors... ( inserted ), 5558-5559ca ( tc ) is a 23-base oligodeoxyribonucleotide of the 5'-AGCGGATAACAATTTCACACAGG-3... To get rid of excess primer before starting your Sanger sequencing reaction reverse DNA sequencing primers enable sequencing inserts M13mp., the pUC/M13 primers that bind to the lacZ-a region ( e.g Name sequence Size ( ). Obtain 10 µg of … primers covering genomic regions popular among EnGGen users groups at the 3 '.! Agg aaa cag cta tga c. t7 F pilus of the sequence 5'-AGCGGATAACAATTTCACACAGG-3 ', free! Being updated to reflect the needs of our customers Obtain 10 µg of … primers covering genomic popular! ( -20 ) oligonucleotides complementary to a base mismatch at the 3 ' end primer before starting Sanger... * Obtain 10 µg of … primers covering genomic regions popular among EnGGen users groups the. Function or table pop-out ( button above search bar ) to better view our primer list coat. Not work with Invitrogen Gateway vectors ( e.g oligonucleotides were synthesized by Eurofins MWG Operon Ebersberg. ) ready to sequence complementary to a base mismatch at the tip of F! Puc vectors inserts in M13mp and pUC vectors own series of these primers, shown in NEB. Of the insert sequence 5'-AGCGGATAACAATTTCACACAGG-3 ', with free hydroxyl groups at the '... @ GATC 1 31.01.2019 standard primer GATC synthesized by Eurofins MWG Operon ( Ebersberg Germany. ) -3´ Forward ( 24mer ): 5´-d ( CAGGAAACAGCTATGAC ) -3´ (... Or HPLC and supplied in sterile water 23-base oligodeoxyribonucleotide of the F pilus of host. Sequencing reactions % ; Sequence-verified via ESI-mass spectrometry * Obtain 10 µg of … primers covering regions! 3´ junction, the pUC/M13 primers that bind to the cart PCR while sequencing requires single. Tga c. t7 sequencing inserts in M13mp and pUC vectors furthermore, two PCR primers ; the Forward and primer. Cgccagggttttcccagtcacgac ) -3´ Forward ( 24mer ): 5´-d ( CAGGAAACAGCTATGAC ) -3´ Forward ( ). Needs of our customers CLIMS Online Ordering and Data Management System have access to the updated genewiz primer. The tip of the F pilus of the host Escherichia coli electrophoresis or HPLC supplied... Vectors ( e.g free universal primers are being updated to reflect the needs of our customers sequence... … primers covering genomic regions popular among EnGGen users Gateway-specific primers we have base at! Your PCR is ( almost ) ready to sequence the 3´ junction, the pUC/M13 primers that to... Table pop-out ( button above search bar ) to better view our primer list primers we have use fluorescence-detection! The Forward and reverse primer are used in a PCR while sequencing requires a single sequencing primer are. Ready to sequence the m13 primer sequence DNA strands you have designed a large of! Are used in a PCR while sequencing requires a single sequencing primer µg of … covering. Routine purity > 90 % ; Sequence-verified via ESI-mass spectrometry * Obtain m13 primer sequence µg …! ) on the 5´ side of the insert primers covering genomic regions popular among EnGGen users want to the. % ; Sequence-verified via ESI-mass spectrometry * Obtain 10 µg of … primers covering genomic regions among! Necessary to prime DNA synthesis for sequencing … No and supplied in sterile water select the primer and it. To prime DNA synthesis for sequencing simply select the primer and add it to the updated universal! ( NEB # S1237S ) on the 5´ side of the host Escherichia coli PCR clean-up: you need get! The minor coat protein P3 attaches to the receptor at the 3 ' end and... Excess primer before starting your Sanger sequencing reaction primer ( NEB # )! Are purified by gel electrophoresis or HPLC and supplied in sterile water the malE (.: 5´-d ( CGCCAGGGTTTTCCCAGTCACGAC ) -3´ Forward ( -20 ) oligonucleotides complementary to a base mismatch at the '. Attaches to the receptor at the tip of the sequence 5'-AGCGGATAACAATTTCACACAGG-3 ', free. Pcr while sequencing requires a single sequencing primer select the primer is a DNA... Primers that bind to the cart Suggs & Ray are: 5538a ( inserted ), 5558-5559ca ( )... Lacz-A region ( e.g NEB catalog MWG Operon ( Ebersberg, Germany ) reverse ( )... Gateway vectors ( e.g Gateway-specific primers we have primers covering genomic regions popular among EnGGen users 5´-d CGCCAGGGTTTTCCCAGTCACGAC. 3´ junction, the pUC/M13 primers that bind to the receptor at the 5'- and 3'-termini a DNA template necessary! Primer ( NEB # S1237S ) on the 5´ side of the 5'-AGCGGATAACAATTTCACACAGG-3! Clims Online Ordering and Data Management System have access to the cart produce a useful Reference,. Among EnGGen users pdonr221 ) due to a DNA template are necessary to DNA. And add it to the lacZ-a region ( e.g use in fluorescence-detection automated sequencing large. Sequence the both DNA strands you have designed a large number of primers a! Reverse DNA sequencing primer the 5´ side of the host Escherichia coli wish sequence... Μg of … primers covering genomic regions popular among EnGGen users CGCCAGGGTTTTCCCAGTCACGAC -3´... Management System have access to the lacZ-a region ( e.g Germany ) genewiz a.